| Species | Cryptococcus neoformans var. grubii H99 |
|---|---|
| Gene Annotation | nuclear protein |
| Gene Name | ASG101 |
| TF Family Name | Zn2Cys6 (Classification based on Fungal Transcription Factor DB) |
| KEGG Linkout | KEGG::CNC00670 |
| Genome Browser | JBrowse link goes here. Sequence information also available from JBrowse. |
| Functional Annotation | |
| Notation | Condition | Normalized Raw Expression |
|---|---|---|
| A | YPD 30°C, concentration: 2x 10^8 cells/ml | 2,592 |
| B | YPD 30°C, concentration: 5x10^7 cells/ml | 3,001 |
| C | YPD 30°C, fluconazole treatment, concentration: 5x10^7 cells/ml | 3,045 |
| D | YPD 30°C, SDS 0.01% treatment, concentration: 5x10^7 cells/ml | 2,187 |
| E | YPD 37°C, concentration: 5x10^7 cells/ml | 2,343 |
| F | YP+galactose 30°C, concentration: 2x10^8 cells/ml | 2,855 |
| Primer Name | Primer Description | Sequence |
|---|---|---|
| L1 | 5' flanking region primer 1 | AGCCGTTTGTCATTCTGC |
| L2 | 5' flanking region primer 2 | TCACTGGCCGTCGTTTTACGTCGTTGCTCATTTTGCG |
| PO | Southern blot probe primer | CAAAAAGTGTCAGCACGC |
| R1 | 3' flanking region primer 1 | CATGGTCATAGCTGTTTCCTGGCGAACCTCCAATAAAGC |
| R2 | 3' flanking region primer 2 | CCCTTTTTTCCCTGCTTC |
| SO | diagnostic screening primer, pairing with B79 | AATAGGGATGCCAACCAG |
| Growth | |
|---|---|
![]() |
|
| Mating Data | |
![]() |
|
| Virulence Factor Production | |
| Capsule | Urease |
![]() |
![]() |
| Melanin | |
![]() |
|
| Stress Response and Adaptation | |
| Osmotic Stress | |
![]() |
|
| Oxidative Stress | Heavy Metal Stress |
![]() |
![]() |
| Cell Wall Stress | |
![]() | |
| Antifungal Drug Susceptibility | |
![]() |
|
| Virulence Data by the Insect Host Model (Galleria mellonella) | |
![]() |
|
| Lung Infectivity Data by the Signature-tag Mutagenesis-based Murine Host Model | |
![]() |
|