| Species | Cryptococcus neoformans var. grubii H99 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Gene Annotation | GATA type zinc finger protein asd-4 | |||||||||
| Gene Name | GAT1 | |||||||||
| TF Family Name | Not defined (Classification based on Fungal Transcription Factor DB) | |||||||||
| KEGG Linkout | KEGG::CNA01820 |
|||||||||
| Genome Browser | JBrowse link goes here. Sequence information also available from JBrowse. | |||||||||
| Functional Annotation |
|
|||||||||
|
||||||||||
| Notation | Condition | Normalized Raw Expression |
|---|---|---|
| A | YPD 30°C, concentration: 2x 10^8 cells/ml | 11,346 |
| B | YPD 30°C, concentration: 5x10^7 cells/ml | 6,283 |
| C | YPD 30°C, fluconazole treatment, concentration: 5x10^7 cells/ml | 6,118 |
| D | YPD 30°C, SDS 0.01% treatment, concentration: 5x10^7 cells/ml | 7,990 |
| E | YPD 37°C, concentration: 5x10^7 cells/ml | 10,894 |
| F | YP+galactose 30°C, concentration: 2x10^8 cells/ml | 9,972 |
| Primer Name | Primer Description | Sequence |
|---|---|---|
| L1 | 5' flanking region primer 1 | GGGCAGAAATAGTTGGCAG |
| L2 | 5' flanking region primer 2 | CTGGCCGTCGTTTTACTTTTTCCCCCCGATGTAG |
| PO2 | Southern blot probe primer | TGCTGAGAGACAGGGAATC |
| R1 | 3' flanking region primer 1 | GTCATAGCTGTTTCCTGTTCCCGCAAGAACAGTGTC |
| R2 | 3' flanking region primer 2 | TTCAGGATGTCCAAACTCAG |
| SO1 | diagnostic screening primer, pairing with B79 | AAGGGGTAAGAAATCGGGC |
| Growth | |
|---|---|
![]() |
|
| Mating Data | |
![]() |
|
| Virulence Factor Production | |
| Capsule | Urease |
![]() |
![]() |
| Melanin | |
![]() |
|
| Stress Response and Adaptation | |
| Osmotic Stress | |
![]() |
|
| Oxidative Stress | Heavy Metal Stress |
![]() |
![]() |
| Cell Wall Stress | |
![]() | |
| Antifungal Drug Susceptibility | |
![]() |
|
| Virulence Data by the Insect Host Model (Galleria mellonella) | |
![]() |
|
| Lung Infectivity Data by the Signature-tag Mutagenesis-based Murine Host Model | |
![]() |
|