Species | Cryptococcus neoformans var. grubii H99 |
---|---|
Gene Annotation | hypothetical protein |
Gene Name | GAT5 |
TF Family Name | HMG (Classification based on Fungal Transcription Factor DB) |
KEGG Linkout | KEGG::CNL04700 ![]() |
Genome Browser | JBrowse link goes here. Sequence information also available from JBrowse. |
Functional Annotation | |
Notation | Condition | Normalized Raw Expression |
---|---|---|
A | YPD 30°C, concentration: 2x 10^8 cells/ml | 1,818 |
B | YPD 30°C, concentration: 5x10^7 cells/ml | 2,735 |
C | YPD 30°C, fluconazole treatment, concentration: 5x10^7 cells/ml | 3,016 |
D | YPD 30°C, SDS 0.01% treatment, concentration: 5x10^7 cells/ml | 3,074 |
E | YPD 37°C, concentration: 5x10^7 cells/ml | 2,608 |
F | YP+galactose 30°C, concentration: 2x10^8 cells/ml | 2,816 |
Primer Name | Primer Description | Sequence |
---|---|---|
L1 | 5' flanking region primer 1 | AAAACCAAGTGGAACCCG |
L2 | 5' flanking region primer 2 | CTGGCCGTCGTTTTACTGGTTGACGCTGTTAGCAC |
PO2 | Southern blot probe primer | CGGCGATAAGGTTTTTGC |
R1 | 3' flanking region primer 1 | GTCATAGCTGTTTCCTGATAGGCAGGCTGGTGGAAAC |
R2 | 3' flanking region primer 2 | ACCACATTTGCTTCCGAGC |
SO1 | diagnostic screening primer, pairing with JOHE12579 | TGGCTGAACTGTAGGTTAGTG |
Growth | |
---|---|
![]() |
|
Mating Data | |
![]() |
|
Virulence Factor Production | |
Capsule | Urease |
![]() |
![]() |
Melanin | |
![]() |
|
Stress Response and Adaptation | |
Osmotic Stress | |
![]() |
|
Oxidative Stress | Heavy Metal Stress |
![]() |
![]() |
Cell Wall Stress | |
![]() | |
Antifungal Drug Susceptibility | |
![]() |
|
Virulence Data by the Insect Host Model (Galleria mellonella) | |
![]() |
|
Lung Infectivity Data by the Signature-tag Mutagenesis-based Murine Host Model | |
![]() |